Date: 30.12.2019
Wishes to New Year in genetic code
We have already wished you in Czech and English language, however, we would like to add few words now also in genetic code as it is the field of our research, too.
In the upcoming year 2020, we wish to all of you:
GGTTAGTAGGATCATGAAGCTTTAACTCATCATGCTCCTCCTATTAATGAATCTTCTGCTAATGATTCTTGATGTTGTGAATCTTCTATTAATTGGTAGCGTAAAGCTTCTTGGGAATTATTAGCTTCTATTAATTATTAGTGACGTCCTGAACGTTCTTAGAATGCTTTATTAATTTTTGAA
Text of the wish uses alternative translation of STOP-codon "TAG" and can be simply copied and translated by our web program DNA encoder. You can use this program not only to create similar text in genetic code, but also to teach or to demonstrate how genetic code works.
